Review



cfx connect real time system  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad cfx connect real time system
    Cfx Connect Real Time System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 15572 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13092056-119-26-30
    Average 99 stars, based on 15572 article reviews
    cfx connect real time system - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    other:

    Article Title: MeCP2 regulates cell-type-specific functions of depressive-like symptoms in the nucleus accumbens.
    Article Snippet: Complementary DNA was synthesized from the extracted RNA using the ReverTra Ace qPCR RT Master Mix (TOYOBO).

    Real-time Polymerase Chain Reaction:

    Article Title: Biomimetic Microfibers for Myelin-Enhancer Screening and Neural Regeneration
    Article Snippet: Quantitative polymerase chain reaction (PCR) was performed using KAPA SYBR Fast Master Mix (KAPA Biosystems) with the following primer pairs: SIGMA1R forward, GTCCGAGTATGTGCTGCTCTTC; SIGMA1R reverse, GAAGACCTCACTTTTGGTGGTGC; GAPDH forward, AGGGCTGCTTTTAACTCTGGT; GAPDH reverse, CCCCACTTGATTTTGGAGGGA. .. The CFX Connect Real-Time PCR Detection System (Bio-Rad) was used to perform the PCR, which consisted of one cycle at 95 °C for 30 s, followed by 39 cycles of 95 °C for 5 s and 60 °C for 45 s. A melting analysis was performed after PCR to assess amplification specificity. ..

    Article Title: Near‐Source Wastewater Surveillance of SARS‐CoV‐2, Influenza A, and Respiratory Syncytial Virus With Spatiotemporal Evaluation of Pepper Mild Mottle Virus as a Fecal Indicator
    Article Snippet: The protocol was modified to process 0.3 mL of concentrate with 0.6 mL of lysis buffer, yielding a 0.1‐mL elution. cDNA synthesis followed the NEB #M0368 protocol (New England Biolabs, MA, USA) with dNTP and random hexamer volumes specified in Table . .. Target quantification was performed via two‐step RT‐qPCR using the CFX Connect Real‐Time PCR Detection System (Bio‐Rad, Hercules, CA, USA). .. Each 20.0‐μL reaction contained 10‐μL TaqMan Fast Advanced Master Mix (ThermoFisher Scientific, MA, USA), 1.0 μL each of forward and reverse primers, 0.5‐μL probe, 4.5‐μL PCR‐grade water, and 3.0 μL of cDNA template.

    Article Title: Repetitive transcranial magnetic stimulation suppresses glia-associated neuroinflammation and promotes peripheral nerve recovery in neuropathic pain
    Article Snippet: RNA concentration was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, USA) by measuring optical density at 260 nm. .. First-strand complementary DNA was synthesized using the Maxime RT PreMix Kit (#25081, iNtRON, USA) with 1 mg of total RNA and the provided oligo primer, following the manufacturer’s instructions. qRT-PCR was performed using the CFX Connect Real-Time PCR Detection System (#1855201, Bio-Rad, USA), with AccuPower 2X GreenStar qPCR Master Mix (#K-6254, Bioneer, USA) and 100 ng of complementary DNA per reaction. ..

    Article Title: Mitochondria-targeted antioxidant mitoquinone attenuates TGF-β-induced fibrosis and restores impaired decidualization in mouse endometrial stromal cells.
    Article Snippet: Total RNA was extracted using the TRIzol reagent, and 1 μg of RNA was reverse-transcribed using SuperScript IV (Invitrogen). .. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using SYBR Green chemistry on a CFX Connect Real-Time PCR Detection System (Bio-Rad). ..

    Article Title: Screening for novel chemical scaffolds targeting PCNA identifies the Hsp90alpha inhibitor SNX-2112
    Article Snippet: .. Thermal shift assays were performed using a BioRad CFX Connect Real-Time PCR Detection System. .. The protein (PCNA), 200x SYPRO orange dye (Sigma), and each of the 59 AI-CADD hits were diluted into Dulbecco's phosphate buffered saline (1x DPBS, no calcium, no magnesium).

    Article Title: The YAP1-NPM1 nuclear complex regulates MYC and reveals a targetable oncogenic node
    Article Snippet: .. All qPCR reactions were performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories). .. Cells (2 x 10ˆ4) were plated in Falcon 8-chamber slides with a glass bottom (Corning, Cat# 354108).

    Article Title: Hyperacetylation escalates myocardial susceptibility to ischemia reperfusion injury by mediating mitochondrial supercomplexes assembly in T2DM
    Article Snippet: Total RNA was extracted from heart tissues or cultured cardiomyocytes using TRIzol (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using the iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, Inc.) according to the manufacturer's guidelines. .. Real-time quantitative PCR was performed using 2 × iTaqTM Universal SYBR-Green Supermix (Bio-Rad Laboratories, Inc.) on a CFX Connect Real-time PCR Detection system (Bio-Rad Laboratories, Inc.). ..

    Polymerase Chain Reaction:

    Article Title: Biomimetic Microfibers for Myelin-Enhancer Screening and Neural Regeneration
    Article Snippet: Quantitative polymerase chain reaction (PCR) was performed using KAPA SYBR Fast Master Mix (KAPA Biosystems) with the following primer pairs: SIGMA1R forward, GTCCGAGTATGTGCTGCTCTTC; SIGMA1R reverse, GAAGACCTCACTTTTGGTGGTGC; GAPDH forward, AGGGCTGCTTTTAACTCTGGT; GAPDH reverse, CCCCACTTGATTTTGGAGGGA. .. The CFX Connect Real-Time PCR Detection System (Bio-Rad) was used to perform the PCR, which consisted of one cycle at 95 °C for 30 s, followed by 39 cycles of 95 °C for 5 s and 60 °C for 45 s. A melting analysis was performed after PCR to assess amplification specificity. ..

    Amplification:

    Article Title: Biomimetic Microfibers for Myelin-Enhancer Screening and Neural Regeneration
    Article Snippet: Quantitative polymerase chain reaction (PCR) was performed using KAPA SYBR Fast Master Mix (KAPA Biosystems) with the following primer pairs: SIGMA1R forward, GTCCGAGTATGTGCTGCTCTTC; SIGMA1R reverse, GAAGACCTCACTTTTGGTGGTGC; GAPDH forward, AGGGCTGCTTTTAACTCTGGT; GAPDH reverse, CCCCACTTGATTTTGGAGGGA. .. The CFX Connect Real-Time PCR Detection System (Bio-Rad) was used to perform the PCR, which consisted of one cycle at 95 °C for 30 s, followed by 39 cycles of 95 °C for 5 s and 60 °C for 45 s. A melting analysis was performed after PCR to assess amplification specificity. ..

    Synthesized:

    Article Title: Repetitive transcranial magnetic stimulation suppresses glia-associated neuroinflammation and promotes peripheral nerve recovery in neuropathic pain
    Article Snippet: RNA concentration was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, USA) by measuring optical density at 260 nm. .. First-strand complementary DNA was synthesized using the Maxime RT PreMix Kit (#25081, iNtRON, USA) with 1 mg of total RNA and the provided oligo primer, following the manufacturer’s instructions. qRT-PCR was performed using the CFX Connect Real-Time PCR Detection System (#1855201, Bio-Rad, USA), with AccuPower 2X GreenStar qPCR Master Mix (#K-6254, Bioneer, USA) and 100 ng of complementary DNA per reaction. ..

    Quantitative RT-PCR:

    Article Title: Repetitive transcranial magnetic stimulation suppresses glia-associated neuroinflammation and promotes peripheral nerve recovery in neuropathic pain
    Article Snippet: RNA concentration was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, USA) by measuring optical density at 260 nm. .. First-strand complementary DNA was synthesized using the Maxime RT PreMix Kit (#25081, iNtRON, USA) with 1 mg of total RNA and the provided oligo primer, following the manufacturer’s instructions. qRT-PCR was performed using the CFX Connect Real-Time PCR Detection System (#1855201, Bio-Rad, USA), with AccuPower 2X GreenStar qPCR Master Mix (#K-6254, Bioneer, USA) and 100 ng of complementary DNA per reaction. ..

    SYBR Green Assay:

    Article Title: Mitochondria-targeted antioxidant mitoquinone attenuates TGF-β-induced fibrosis and restores impaired decidualization in mouse endometrial stromal cells.
    Article Snippet: Total RNA was extracted using the TRIzol reagent, and 1 μg of RNA was reverse-transcribed using SuperScript IV (Invitrogen). .. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using SYBR Green chemistry on a CFX Connect Real-Time PCR Detection System (Bio-Rad). ..

    Article Title: Hyperacetylation escalates myocardial susceptibility to ischemia reperfusion injury by mediating mitochondrial supercomplexes assembly in T2DM
    Article Snippet: Total RNA was extracted from heart tissues or cultured cardiomyocytes using TRIzol (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using the iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, Inc.) according to the manufacturer's guidelines. .. Real-time quantitative PCR was performed using 2 × iTaqTM Universal SYBR-Green Supermix (Bio-Rad Laboratories, Inc.) on a CFX Connect Real-time PCR Detection system (Bio-Rad Laboratories, Inc.). ..



    Similar Products

    99
    Bio-Rad cfx connect real time system
    Cfx Connect Real Time System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13092056-119-26-30
    Average 99 stars, based on 1 article reviews
    cfx connect real time system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad real time pcr detection system
    Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc12963995-402-8-14
    Average 99 stars, based on 1 article reviews
    real time pcr detection system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx opus real time pcr system
    Cfx Opus Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13156693-293-20-25
    Average 99 stars, based on 1 article reviews
    cfx opus real time pcr system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad real time pcr system
    Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13158610-60-5-8
    Average 99 stars, based on 1 article reviews
    real time pcr system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx connecttm real time pcr detection system
    Cfx Connecttm Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc12999302-75-9-15
    Average 99 stars, based on 1 article reviews
    cfx connecttm real time pcr detection system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad cfx connect real time pcr detection system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Connect Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Maestro+Software/pmc12930076-116-7-7
    Average 98 stars, based on 1 article reviews
    bio rad cfx connect real time pcr detection system - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx connect real time pcr detection system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Cfx Connect Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13091559-79-17-23
    Average 99 stars, based on 1 article reviews
    cfx connect real time pcr detection system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx connect real time pcr system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Cfx Connect Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13148005-206-7-12
    Average 99 stars, based on 1 article reviews
    cfx connect real time pcr system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .

    Journal: Current Research in Structural Biology

    Article Title: Screening for novel chemical scaffolds targeting PCNA identifies the Hsp90alpha inhibitor SNX-2112

    doi: 10.1016/j.crstbi.2026.100183

    Figure Lengend Snippet: PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .

    Article Snippet: Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM.

    Techniques: Thermal Shift Assay, Control, Real-time Polymerase Chain Reaction, Concentration Assay, Recombinant, Purification, Fluorescence, Negative Control, Produced, Maestro Software