cfx connect real time system (Bio-Rad)
Bio-Rad is a verified supplier 
99
Structured Review
Bio-Rad
cfx connect real time system
Cfx Connect Real Time System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 15377 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13092056-119-26-30
Average 99 stars, based on 15377 article reviews
Cfx Connect Real Time System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 15377 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cfx+connect+real+time+pcr+detection+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13092056-119-26-30
Average 99 stars, based on 15377 article reviews
cfx connect real time system - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
other:Article Title: MeCP2 regulates cell-type-specific functions of depressive-like symptoms in the nucleus accumbens. Article Snippet: Complementary DNA was synthesized from the extracted RNA using the ReverTra Ace qPCR RT Master Mix (TOYOBO). Real-time Polymerase Chain Reaction:Article Title: Biomimetic Microfibers for Myelin-Enhancer Screening and Neural Regeneration Article Snippet: Quantitative polymerase chain reaction (PCR) was performed using KAPA SYBR Fast Master Mix (KAPA Biosystems) with the following primer pairs: SIGMA1R forward, GTCCGAGTATGTGCTGCTCTTC; SIGMA1R reverse, GAAGACCTCACTTTTGGTGGTGC; GAPDH forward, AGGGCTGCTTTTAACTCTGGT; GAPDH reverse, CCCCACTTGATTTTGGAGGGA. .. The Article Title: Near‐Source Wastewater Surveillance of SARS‐CoV‐2, Influenza A, and Respiratory Syncytial Virus With Spatiotemporal Evaluation of Pepper Mild Mottle Virus as a Fecal Indicator Article Snippet: The protocol was modified to process 0.3 mL of concentrate with 0.6 mL of lysis buffer, yielding a 0.1‐mL elution. cDNA synthesis followed the NEB #M0368 protocol (New England Biolabs, MA, USA) with dNTP and random hexamer volumes specified in Table . .. Target quantification was performed via two‐step RT‐qPCR using the Article Title: Repetitive transcranial magnetic stimulation suppresses glia-associated neuroinflammation and promotes peripheral nerve recovery in neuropathic pain Article Snippet: RNA concentration was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, USA) by measuring optical density at 260 nm. .. First-strand complementary DNA was synthesized using the Maxime RT PreMix Kit (#25081, iNtRON, USA) with 1 mg of total RNA and the provided oligo primer, following the manufacturer’s instructions. qRT-PCR was performed using the Article Title: Mitochondria-targeted antioxidant mitoquinone attenuates TGF-β-induced fibrosis and restores impaired decidualization in mouse endometrial stromal cells. Article Snippet: Total RNA was extracted using the TRIzol reagent, and 1 μg of RNA was reverse-transcribed using SuperScript IV (Invitrogen). .. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using SYBR Green chemistry on a Article Title: Screening for novel chemical scaffolds targeting PCNA identifies the Hsp90alpha inhibitor SNX-2112 Article Snippet: .. Thermal shift assays were performed using a BioRad Article Title: The YAP1-NPM1 nuclear complex regulates MYC and reveals a targetable oncogenic node Article Snippet: .. All qPCR reactions were performed using the Article Title: Hyperacetylation escalates myocardial susceptibility to ischemia reperfusion injury by mediating mitochondrial supercomplexes assembly in T2DM Article Snippet: Total RNA was extracted from heart tissues or cultured cardiomyocytes using TRIzol (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using the iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, Inc.) according to the manufacturer's guidelines. .. Real-time quantitative PCR was performed using 2 × iTaqTM Universal SYBR-Green Supermix (Bio-Rad Laboratories, Inc.) on a Polymerase Chain Reaction:Article Title: Biomimetic Microfibers for Myelin-Enhancer Screening and Neural Regeneration Article Snippet: Quantitative polymerase chain reaction (PCR) was performed using KAPA SYBR Fast Master Mix (KAPA Biosystems) with the following primer pairs: SIGMA1R forward, GTCCGAGTATGTGCTGCTCTTC; SIGMA1R reverse, GAAGACCTCACTTTTGGTGGTGC; GAPDH forward, AGGGCTGCTTTTAACTCTGGT; GAPDH reverse, CCCCACTTGATTTTGGAGGGA. .. The Amplification:Article Title: Biomimetic Microfibers for Myelin-Enhancer Screening and Neural Regeneration Article Snippet: Quantitative polymerase chain reaction (PCR) was performed using KAPA SYBR Fast Master Mix (KAPA Biosystems) with the following primer pairs: SIGMA1R forward, GTCCGAGTATGTGCTGCTCTTC; SIGMA1R reverse, GAAGACCTCACTTTTGGTGGTGC; GAPDH forward, AGGGCTGCTTTTAACTCTGGT; GAPDH reverse, CCCCACTTGATTTTGGAGGGA. .. The Synthesized:Article Title: Repetitive transcranial magnetic stimulation suppresses glia-associated neuroinflammation and promotes peripheral nerve recovery in neuropathic pain Article Snippet: RNA concentration was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, USA) by measuring optical density at 260 nm. .. First-strand complementary DNA was synthesized using the Maxime RT PreMix Kit (#25081, iNtRON, USA) with 1 mg of total RNA and the provided oligo primer, following the manufacturer’s instructions. qRT-PCR was performed using the Quantitative RT-PCR:Article Title: Repetitive transcranial magnetic stimulation suppresses glia-associated neuroinflammation and promotes peripheral nerve recovery in neuropathic pain Article Snippet: RNA concentration was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, USA) by measuring optical density at 260 nm. .. First-strand complementary DNA was synthesized using the Maxime RT PreMix Kit (#25081, iNtRON, USA) with 1 mg of total RNA and the provided oligo primer, following the manufacturer’s instructions. qRT-PCR was performed using the SYBR Green Assay:Article Title: Mitochondria-targeted antioxidant mitoquinone attenuates TGF-β-induced fibrosis and restores impaired decidualization in mouse endometrial stromal cells. Article Snippet: Total RNA was extracted using the TRIzol reagent, and 1 μg of RNA was reverse-transcribed using SuperScript IV (Invitrogen). .. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using SYBR Green chemistry on a Article Title: Hyperacetylation escalates myocardial susceptibility to ischemia reperfusion injury by mediating mitochondrial supercomplexes assembly in T2DM Article Snippet: Total RNA was extracted from heart tissues or cultured cardiomyocytes using TRIzol (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using the iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories, Inc.) according to the manufacturer's guidelines. .. Real-time quantitative PCR was performed using 2 × iTaqTM Universal SYBR-Green Supermix (Bio-Rad Laboratories, Inc.) on a |
